ESTRO 2021 Abstract Book

S957

ESTRO 2021

Purpose or Objective Fluoro-D-glucose uptake of the primary tumor has been identified as an independent prognostic indicator for survival in early stage Non Small Lung Cancer (NSCLC) at diagnosis. However, its prognostic value has been found disappointing in advanced NSCLC. The most commonly used parameter to quantify a lesion on PET is the maximum standardized uptake value (SUVmax). The prognostic value of FDG-PET after induction treatment has not been studied as entirely as at diagnosis. Purpose of our study was to evaluate the prognostic role of SUVmax of primary tumor and lymph nodes using [18F]FDG PET-CT for radiotherapy planning after induction chemotherapy (ChT) in patients with locally advanced NSCLC. Materials and Methods Fifty-seven patients (46 male, 11 female) with locally advanced NSCLC and [18F]FDG PET-CT images for radiotherapy planning were evaluated. All patients (pts) were treated with radical radiotherapy after induction ChT from 2012 to 2017. Forty-two pts had squamous cell carcinomas and 15 had adenocarcinomas. The time between [18F]FDG PET-CT imaging and treatment outcomes was calculated based on the dependence of the primary tumor and lymph nodes SUVmax values. Results Median follow-up duration was 18 months (range 6-72). The mean SUVmax of primary tumor was 10.72 (range: 0–36.14) and 3.12 of lymph nodes (range: 0–16.5). We assumed that the minimum SUVmax values of the primary tumor and the SUVmax of the lymph nodes, which were 0 after induction ChT, were a good response to ChT. Primary tumor SUVmax greater than 10.72 did not correlate with worse overall survival (OS) (p = 0.839642), as well as lymph nodes SUVmax greater than 3.12 (p=0.526905). Also, there was no effect on disease free survival (DFS) with higher SUVmax of the lymph nodes (p = 0.886135), however, an effect on DFS was observed regarding to the higher primary tumor SUVmax (p = 0.022695). The 2-year DFS and OS for the whole group of patients were 28%, 33%, respectively. Conclusion We did not find a correlation between SUVmax of the primary tumor and lymph nodes and prognosis in patients who had [18F]FDG PET-CT for radiotherapy planning after induction ChT. The use of [18F]FDG PET-CT for radiotherapy planning after induction treatment has not been shown to be a reliable way to predict survival of patients and disease aggressiveness. PO-1151 Long non-coding RNA NEAT1 levels expression associate with local recurrence in lung cancer patients I. Paguey Garrido 1 , O. Muñoz Muñoz 1 , B.D. Delgado Leon 1 , J. Jaen Olasolo 2 , M.V. Enguix Riego 1 , S. Perez Luque 1 , M. Borrego Reina 1 , P. Romero Pareja 1 , J.L. Lopez Guerra 1 1 University Hospital Virgen del Rocío, Department of Radiation Oncology, Seville, Spain; 2 University Hospital Puerta del Mar , Department of Radiation Oncology, Cadiz, Spain Purpose or Objective NEAT1 (Nuclear Paraspeckle Assembly Transcript 1) is an RNA gene, and is affiliated with the long noncoding RNAs (lncRNAs) class. It is essential for the formation of nuclear bodies called paraspeckles (PSs). Although their exact function still has to be fully elucidated, PSs are proposed to be potentially involved in stress response and NEAT1 has been found to contribute to the radioresistance in lung cancer. We investigated whether these findings translate into the clinic. Materials and Methods Between February 2016 and October 2017, a total of 94 lung cancer patients (65 non-small cell [NSCLC] and 29 small cell lung cancer [SCLC]) were assessed prospectively. The cohort consisted of 73 [77%] males and 21 [23%] females with a median age of 63 years. Patients were predominantly locally advanced (82%: stage IIIa— b). The last follow-up was performed in March 2021 with a median follow-up time of 21 months. All patients received radiotherapy (median dose 66Gy) and 89% chemotherapy. Eleven percent of NSCLC patients underwent surgery before radiation. Peripheral blood samples were collected from lung cancer patients one month before starting radiotherapy. LncRNA expression profiling was performed using Custom TaqMan® lncRNA Expression Array Plates containing the selected lncRNA probe (NEAT1) at Viia7 Real Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) under the following conditions: 50ºCx2´, [95ºCx10´, 95ºCx15´´, 60ºCx1´, 60ºC] x40. The data was analyzed using the comparative Cτ method to quantify relative gene expression (ΔΔCτ). Quantitative real-time reverse-transcription PCR (qRT-PCR) cDNA was generated and amplified using the following primer pair: NEAT1: 5´- TTGGTTCTGAGCTGCGTCTA -3´/5´- TCATCCCCAAGTCATTGGTT -3´. Results After a median follow up of 21 months, 26 (28%) patients were alive and 71 (76%) experienced recurrence (39 [41%] locally). LncRNA NEAT1 expression levels ranged between 0 and 1687.88 (median 1.88). Multivariate analysis showed that LncRNA NEAT1 higher (>median) expression associated with higher local recurrence (LR) for all patients (HR 2.02; 95% CI: 1.05-3.91; p=0.036; 2y LR: 60% vs 37%). The multivariate analysis also showed an increased risk of higher LR in both NSCLC (HR 2.74; 95% CI: 1.18-6.36; p=0.019; 2y LR: 57% vs 32%) and SCLC (HR 3.40; 95% CI: 1.06-10.88; p=0.040; 2y LR: 86% vs 32%) patients when analyzing them separately. Similar results were found for NSCLC patients when analyzing the disease-free survival (HR 2.13; 95% CI: 1.15-3.94; p=0.016; 2y Recurrence (local and distant): 80% vs 52%). Conclusion This study indicates that LncRNA NEAT1 levels expression in peripheral blood mononuclear cells associate with LR in both NSCLC and SCLC patients. This prognostic biomarker may be useful for guiding therapy intensity in an individualized treatment, and suggests application in molecular targeted therapy.

PO-1152 Analysis of chest wall toxicity predictors in lung SBRT. 3-fraction schemes for peripheral lesions? D. Aldave 1 , S. Gonzalo 1 , D. Hernandez 2 , L. Zaragoza 1 , J.A. Cruz-Conde 1 , M. Casado 1 , P. Castro 2 , M. Roch 2 , M.S.